MirGeneDB 2.1

MirGeneDB ID

Hsa-Mir-124-P2-v1

Family name MIR-124 (all species)
Seed AAGGCAC
Species Human (Homo sapiens)
MiRBase ID hsa-mir-124-1
Paralogues Hsa-Mir-124-P1-v1  Hsa-Mir-124-P1-v2  Hsa-Mir-124-P2-v2  Hsa-Mir-124-P3-v1  Hsa-Mir-124-P3-v2 
Orthologues Aae-Mir-124  Aca-Mir-124-P2-v1  Aca-Mir-124-P2-v2  Ami-Mir-124-P2-v1  Ami-Mir-124-P2-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Bla-Mir-124  Bta-Mir-124-P2-v1  Bta-Mir-124-P2-v2  Cel-Mir-124  Cfa-Mir-124-P2-v1  Cfa-Mir-124-P2-v2  Cmi-Mir-124-P2-v1  Cmi-Mir-124-P2-v2  Cpi-Mir-124-P2-v1  Cpi-Mir-124-P2-v2  Cpo-Mir-124-P2-v1  Cpo-Mir-124-P2-v2  Cte-Mir-124  Dan-Mir-124  Dma-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dno-Mir-124-P2-v1  Dno-Mir-124-P2-v2  Dpu-Mir-124  Dre-Mir-124-P2a-v1  Dre-Mir-124-P2a-v2  Dsi-Mir-124  Dya-Mir-124  Esc-Mir-124  Ete-Mir-124-P2-v1  Ete-Mir-124-P2-v2  Gga-Mir-124-P2-v1  Gga-Mir-124-P2-v2  Gja-Mir-124-P2-v1  Gja-Mir-124-P2-v2  Hme-Mir-124  Isc-Mir-124  Lan-Mir-124  Lch-Mir-124-P2  Loc-Mir-124-P2-v1  Loc-Mir-124-P2-v2  Mal-Mir-124-P2a-v1  Mal-Mir-124-P2a-v2  Mdo-Mir-124-P2-v1  Mdo-Mir-124-P2-v2  Mml-Mir-124-P2-v1  Mml-Mir-124-P2-v2  Mmu-Mir-124-P2-v1  Mmu-Mir-124-P2-v2  Mun-Mir-124-P2-v1  Mun-Mir-124-P2-v2  Npo-Mir-124  Obi-Mir-124  Ocu-Mir-124-P2-v1  Ocu-Mir-124-P2-v2  Ovu-Mir-124  Pbv-Mir-124-P2-v1  Pbv-Mir-124-P2-v2  Pfl-Mir-124  Pma-Mir-124-o2  Pmi-Mir-124  Rno-Mir-124-P2-v1  Rno-Mir-124-P2-v2  Sha-Mir-124-P2-v1  Sha-Mir-124-P2-v2  Sko-Mir-124  Spt-Mir-124-P2  Spu-Mir-124  Sto-Mir-124-P2-v1  Sto-Mir-124-P2-v2  Tca-Mir-124  Tgu-Mir-124-P2-v1  Tgu-Mir-124-P2-v2  Tni-Mir-124-P2a-v1  Tni-Mir-124-P2a-v2  Tni-Mir-124-P2b-v1  Tni-Mir-124-P2b-v2  Xbo-Mir-124  Xla-Mir-124-P2c-v1  Xla-Mir-124-P2c-v2  Xla-Mir-124-P2d-v1  Xla-Mir-124-P2d-v2  Xtr-Mir-124-P2-v1  Xtr-Mir-124-P2-v2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(hg38)
chr8: 9903399-9903459 [-] UCSC Ensembl
Clustered miRNAs
(< 50kb from Mir-124-P2-v1)
Mir-124-P2-v1 chr8: 9903399-9903459 [-] UCSC Ensembl
Mir-124-P2-v2 chr8: 9903400-9903459 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUCCUUCCUCAGGAGAAAGGCCUCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAAUGGGGCUGGCUGAGCACCGUGGGUCGG
Get precursor sequence
Structure
        10          20        30        40        50          
UUCCUUCCUCAGGAGAAA--|     UC   CC        A   GA       UUAAAUG 
                    GGCCUC  UCU  GUGUUCAC GCG  CCUUGAU       \
                    UCGGGG  AGA  CGUAAGUG CGC  GGAAUUA       U
GGCUGGGUGCCACGAGUCGG^     UA   AC        G   AC       ACAUACC 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Al Al Al Al Al Al Al Al Al Al Al
Star sequence

Hsa-Mir-124-P2-v1_5p*

mirBase accessionMIMAT0004591
Sequence
0- CGUGUUCACAGCGGACCUUGAU -22
Get sequence
Proposed targets microrna.org: MIMAT0004591
TargetScanVert: hsa-miR-124-5p
TargetMiner: hsa-miR-124-5p
miRDB: MIMAT0004591
Mature sequence

Hsa-Mir-124-P2-v1_3p

mirBase accessionMIMAT0000422
Sequence
39- UAAGGCACGCGGUGAAUGCCAA -61
Get sequence
Proposed targets microrna.org: MIMAT0000422
TargetScanVert: hsa-miR-124-3p.1
TargetMiner: hsa-miR-124-3p
miRDB: MIMAT0000422