MirGeneDB 3.0
MirGeneDB ID

Hsa-Mir-193-P2a

Family name MIR-193 (all species)
Seed AAUGCCC
Species Human (Homo sapiens)
MiRBase ID hsa-mir-365a
Paralogues Hsa-Mir-193-P1a  Hsa-Mir-193-P1b  Hsa-Mir-193-P2b 
Orthologues Ami-Mir-193-P2a  Bge-Mir-193-P2  Bta-Mir-193-P2a  Cbr-Mir-193-P2-v1  Cbr-Mir-193-P2-v2  Cel-Mir-193-P2-v1  Cel-Mir-193-P2-v2  Cfa-Mir-193-P2a  Cja-Mir-193-P2a  Cli-Mir-193-P2a  Cmi-Mir-193-P2a  Cpi-Mir-193-P2a  Cpo-Mir-193-P2a  Cte-Mir-193-P2  Dgr-Mir-193-P2  Dlo-Mir-193-P2  Dno-Mir-193-P2a  Dre-Mir-193-P2a  Ebu-Mir-193-P2  Eca-Mir-193-P2a  Ete-Mir-193-P2a  Gga-Mir-193-P2a  Hme-Mir-193-P2  Hru-Mir-193-P2  Laf-Mir-193-P2a  Lch-Mir-193-P2a  Lgi-Mir-193-P2  Llo-Mir-193-P2-v1  Llo-Mir-193-P2-v2  Loc-Mir-193-P2a  Mdo-Mir-193-P2a  Mgi-Mir-193-P2  Mml-Mir-193-P2a  Mmr-Mir-193-P2a  Mmu-Mir-193-P2a  Mun-Mir-193-P2a  Neu-Mir-193-P2a  Oan-Mir-193-P2a  Ocu-Mir-193-P2a  Pab-Mir-193-P2a  Pau-Mir-193-P2  Pbv-Mir-193-P2a  Pdu-Mir-193-P2  Pfl-Mir-193-P2  Pma-Mir-193-P2  Pmi-Mir-193-P2  Pve-Mir-193-P2  Rno-Mir-193-P2a  Rph-Mir-193-P2  Sha-Mir-193-P2a  Sko-Mir-193-P2  Snu-Mir-193-P2  Spt-Mir-193-P2a  Spu-Mir-193-P2  Sro-Mir-193-P2  Sto-Mir-193-P2a  Tca-Mir-193-P2  Tgu-Mir-193-P2a  Xbo-Mir-193-P2  Xla-Mir-193-P2a3  Xla-Mir-193-P2a4  Xtr-Mir-193-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(hg38)		 chr16: 14309300-14309360 [+] UCSC Ensembl
Clustered miRNAs
(< 50kb from Mir-193-P2a)		 Mir-193-P1a chr16: 14303980-14304038 [+] UCSC Ensembl
Mir-193-P2a chr16: 14309300-14309360 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCAGCUGGUUCGUUACCGCAGGGAAAAUGAGGGACUUUUGGGGGCAGAUGUGUUUCCAUUCCACUAUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCAGUAUUCCUCGGGGGUCCCU
Get precursor sequence
Structure
        10          20        30        40        50        60 
GCCAGCUGGUUCGUUACC--|     AA        AC           GA    UUUCCAU 
                    GCAGGG  AAUGAGGG  UUUUGGGGGCA  UGUG       \
                    CGUUCU  UUAUUCCU  AAAAUCCCCGU  AUAC       U
UCCCUGGGGGCUCCUUAUGA^     CG        A-           A-    UAUCACC 
 .       110       100        90         80         70
Deep sequencing
Go to detailed chart
CommentAlthough there is a templated T at the 3' end of the 3p arm, the post-transcriptional addition of a terminal 3' U is supported by the CAGE data from de Rie et al. (2017). All other osteichthyians are treated accordingly. There is also a second Drosha cut -1 on both arms.
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
-   +
Dc Dc Dr Dr Xp Xp Bl Br Br Ce Ce Co Fo He Ki Le Li Li Lu Pa Pl Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Star sequence

Hsa-Mir-193-P2a_5p*
mirBase accessionMIMAT0009199
Sequence 
0- AGGGACUUUUGGGGGCAGAUGUG -23
Get sequence
Proposed targets microrna.org: MIMAT0009199
TargetScanVert: hsa-miR-365a-5p
TargetMiner: hsa-miR-365a-5p
miRDB: MIMAT0009199
Mature sequence

Hsa-Mir-193-P2a_3p
mirBase accessionMIMAT0000710
Sequence 
40- UAAUGCCCCUAAAAAUCCUUA -61
Get sequence
Proposed targets microrna.org: MIMAT0000710
TargetScanVert: hsa-miR-365a-3p
TargetMiner: hsa-miR-365a-3p
miRDB: MIMAT0000710