MirGeneDB 3.0

MirGeneDB ID

Rno-Mir-506-P25

Family name MIR-506 (all species)
Seed CUUCACC
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-3551
Paralogues Rno-Mir-506-P1  Rno-Mir-506-P2b  Rno-Mir-506-P4  Rno-Mir-506-P5  Rno-Mir-506-P11  Rno-Mir-506-P13  Rno-Mir-506-P14  Rno-Mir-506-P15  Rno-Mir-506-P16  Rno-Mir-506-P17  Rno-Mir-506-P18  Rno-Mir-506-P19  Rno-Mir-506-P21  Rno-Mir-506-P22  Rno-Mir-506-P23  Rno-Mir-506-P24 
Orthologues Laf-Mir-506 
Node of Origin (locus) R. norvegicus
Node of Origin (family) Eutheria
Genome context
(rn6)
chrX: 151272836-151272891 [-] UCSC Ensembl
Clustered miRNAs
(< 50kb from Mir-506-P25)
Mir-506-P24 chrX: 151252838-151252893 [-] UCSC Ensembl
Mir-506-P23 chrX: 151253328-151253384 [-] UCSC Ensembl
Mir-506-P22 chrX: 151260323-151260379 [-] UCSC Ensembl
Mir-506-P21 chrX: 151260712-151260770 [-] UCSC Ensembl
Mir-506-P19 chrX: 151272114-151272171 [-] UCSC Ensembl
Mir-506-P25 chrX: 151272836-151272891 [-] UCSC Ensembl
Mir-506-P18 chrX: 151274374-151274430 [-] UCSC Ensembl
Mir-506-P17 chrX: 151276038-151276097 [-] UCSC Ensembl
Mir-506-P16 chrX: 151281998-151282055 [-] UCSC Ensembl
Mir-506-P15 chrX: 151283471-151283527 [-] UCSC Ensembl
Mir-506-P14 chrX: 151283920-151283976 [-] UCSC Ensembl
Mir-506-P13 chrX: 151287797-151287853 [-] UCSC Ensembl
Mir-3580 chrX: 151295627-151295682 [-] UCSC Ensembl
Mir-506-P11 chrX: 151297377-151297433 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAAUUUUAAGUAUCCUAUGGGCAGUACUGUCUUCACCAUGGUGUUUUUGACAUAAGUAGCUAUGAAAUUCACCAUGGUGGGUAAAGUAAGGCUCAUAAUUCUCUCGUUUGUUGUG
Get precursor sequence
Structure
        10          20        30        40        50        
AGAAUUUUAAGUAUCCU--|     AG    GUC            UU   GA   AAG 
                   AUGGGC  UACU   UUCACCAUGGUG  UUU  CAU   U
                   UACUCG  AUGA   GGGUGGUACCAC  AAA  GUA   A
GUGUUGUUUGCUCUCUUAA^     GA    AAU            UU   --   UCG 
    110       100        90        80        70          60
Deep sequencing
Go to detailed chart
CommentThere is a one nucleotide polymorphism in the 3p arm in the assembled sequence relative to the read data.
3' NTU No
MotifsNo
Tissue expression
 +
Dr Dr Ad Bi Bi Bi Bi Br Br Br Br Ce Ce Ce Ce Co Co Co Co Du Du Du Du Fa He He He Hi Hi Il Il Je Je Ki Ki Ki Ki Ki La Li Li Li Li Li Li Lu Me Me Mu Ov Pa Pa Pa Sk Sm So So So So Sp St St St St Te Te Th Ut Wh
Mature sequence

Rno-Mir-506-P25_5p

mirBase accessionMIMAT0017809
Sequence
0- UCUUCACCAUGGUGUUUUUGACAU -24
Get sequence
Proposed targets TargetScanVert: rno-miR-3551-5p
miRDB: MIMAT0017809
Star sequence

Rno-Mir-506-P25_3p*

mirBase accessionMIMAT0017810
Sequence
33- UGAAAUUCACCAUGGUGGGUAAA -56
Get sequence
Proposed targets TargetScanVert: rno-miR-3551-3p
miRDB: MIMAT0017810