| MirGeneDB ID | Pca-Mir-36-P23 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-36 (all species) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CACCGGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Penis worm (Priapulus caudatus) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pca-Mir-36-P24 Pca-Mir-36-P25 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Agr-Mir-36 Bge-Mir-36 Cbr-Mir-36-o23 Cte-Mir-36 Dgr-Mir-36 Dlo-Mir-36 Dma-Mir-36 Dpu-Mir-36 Eba-Mir-36 Gsp-Mir-36 Isc-Mir-36 Lhy-Mir-36 Llo-Mir-36 Mgi-Mir-36 Mom-Mir-36 Npo-Mir-36 Ofu-Mir-36 Pau-Mir-36 Pcr-Mir-36 Pdu-Mir-36 Pve-Mir-36 Rph-Mir-36 Snu-Mir-36 Tca-Mir-36 War-Mir-36 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | P. caudatus | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Priapulus_caudatus_gca000485595v2) |
KQ715408.1: 303049-303105 [+] UCSC Ensembl | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | UACACCUCCGUUUGUCAGAACGCCUUACUCGGUGCAUGGGUUCCCGGUAGGUGGCGCUGCGAGCAUCACCGGGUACACAUUCAUCCCAGGCUGGUGUUUCUCGUCUGCCCUGCAAGGGet precursor sequence | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UACACCUCCGUUUGUCA- UUA C -| C G U A GCGC GAACGCC CU GG UG AUG GU CCCGGU GGUG U UUUGUGG GA CC AC UAC CA GGGCCA CUAC G GGAACGUCCCGUCUGCUC UCG C U^ U A U - GAGC 110 100 90 80 70 60 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pca-Mir-36-P23_5p* (predicted) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGUGCAUGGGUUCCCGGUAGGUG -23
Get sequence
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pca-Mir-36-P23_3p (predicted) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- UCACCGGGUACACAUUCAUCCC -57
Get sequence
|
