MirGeneDB 2.1

MirGeneDB ID

Hsa-Mir-199-P3-v2

Family name MIR-199 (all species)
Seed ACAGUAG
Species Human (Homo sapiens)
MiRBase ID hsa-mir-199a-1
Paralogues Hsa-Mir-199-P1-v1  Hsa-Mir-199-P1-v2  Hsa-Mir-199-P1-v3  Hsa-Mir-199-P2-v1  Hsa-Mir-199-P2-v2  Hsa-Mir-199-P2-v3  Hsa-Mir-199-P3-v1  Hsa-Mir-199-P3-v3 
Orthologues Aca-Mir-199-P3-v1  Aca-Mir-199-P3-v2  Aca-Mir-199-P3-v3  Ami-Mir-199-P3-v1  Ami-Mir-199-P3-v2  Ami-Mir-199-P3-v3  Bta-Mir-199-P3-v1  Bta-Mir-199-P3-v2  Bta-Mir-199-P3-v3  Cfa-Mir-199-P3-v1  Cfa-Mir-199-P3-v2  Cfa-Mir-199-P3-v3  Cpi-Mir-199-P3-v1  Cpi-Mir-199-P3-v2  Cpi-Mir-199-P3-v3  Cpo-Mir-199-P3-v1  Cpo-Mir-199-P3-v2  Cpo-Mir-199-P3-v3  Dre-Mir-199-P3-v1  Dre-Mir-199-P3-v2  Dre-Mir-199-P3-v3  Ete-Mir-199-P3-v1  Ete-Mir-199-P3-v2  Ete-Mir-199-P3-v3  Gja-Mir-199-P3-v1  Gja-Mir-199-P3-v2  Gja-Mir-199-P3-v3  Gmo-Mir-199-P3-v1  Gmo-Mir-199-P3-v2  Gmo-Mir-199-P3-v3  Lch-Mir-199-P3  Loc-Mir-199-P3-v1  Loc-Mir-199-P3-v2  Mal-Mir-199-P3-v1  Mal-Mir-199-P3-v2  Mal-Mir-199-P3-v3  Mdo-Mir-199-P3-v1  Mdo-Mir-199-P3-v2  Mdo-Mir-199-P3-v3  Mml-Mir-199-P3-v1  Mml-Mir-199-P3-v2  Mml-Mir-199-P3-v3  Mmu-Mir-199-P3-v1  Mmu-Mir-199-P3-v2  Mmu-Mir-199-P3-v3  Mun-Mir-199-P3-v1  Mun-Mir-199-P3-v2  Mun-Mir-199-P3-v3  Ocu-Mir-199-P3-v1  Ocu-Mir-199-P3-v2  Ocu-Mir-199-P3-v3  Pbv-Mir-199-P3-v1  Pbv-Mir-199-P3-v2  Pbv-Mir-199-P3-v3  Pma-Mir-199-o3  Sha-Mir-199-P3-v1  Sha-Mir-199-P3-v2  Sha-Mir-199-P3-v3  Tni-Mir-199-P3-v1  Tni-Mir-199-P3-v2  Tni-Mir-199-P3-v3  Xla-Mir-199-P3a  Xla-Mir-199-P3b  Xtr-Mir-199-P3 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Vertebrata
Genome context
(hg38)
chr19: 10817429-10817491 [-] UCSC Ensembl
Clustered miRNAs
(< 50kb from Mir-199-P3-v2)
Mir-199-P3-v1 chr19: 10817429-10817491 [-] UCSC Ensembl
Mir-199-P3-v2 chr19: 10817429-10817491 [-] UCSC Ensembl
Mir-199-P3-v3 chr19: 10817429-10817491 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUCUGCAGGAUGGAUAGCCGGCCCCGCCAACCCAGUGUUCAGACUACCUGUUCAGGAGGCUCUCAAUGUGUACAGUAGUCUGCACAUUGGUUAGGCUGGGCUUGGGUGAGCGGCUCGUCGAGA
Get precursor sequence
Structure
        10          20        30        40        50        60 
UUCUGCAGGAUGGAUAG-  -|    C   AAC       U        C   U  GGAGGC 
                  CC GGCCC GCC   CCAGUGU CAGACUAC UGU CA      U
                  GG UCGGG CGG   GGUUACA GUCUGAUG ACA GU      C
AGAGCUGCUCGGCGAGUG  U^    U   AUU       C        -   U  GUAACU 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
1- 1- 1- 1- 1- 1- 1- 1- 1- 1- 1- 1- 1- 2- 2- 2- 2- 2- 2- 2- 2- 2- 2- 2- 3- 3- 3- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 5- 5- 5- 5- 5- 5- 5- 6- 6- 6- 6- 6-
Star sequence

Hsa-Mir-199-P3-v2_5p*

mirBase accessionMIMAT0000231
Sequence
0- CCCAGUGUUCAGACUACCUGUUCA -24
Get sequence
Proposed targets microrna.org: MIMAT0000231
TargetScanVert: hsa-miR-199a-5p
TargetMiner: hsa-miR-199a-5p
miRDB: MIMAT0000231
Mature sequence

Hsa-Mir-199-P3-v2_3p

mirBase accessionMIMAT0000232
Sequence
40- UACAGUAGUCUGCACAUUGGUUA -63
Get sequence
Proposed targets microrna.org: MIMAT0000232
TargetScanVert: hsa-miR-199a-3p
TargetMiner: hsa-miR-199a-3p
miRDB: MIMAT0000232