MirGeneDB 2.1

MirGeneDB ID

Hsa-Mir-219-P2

Family name MIR-219 (all species)
Seed GAUUGUC
Species Human (Homo sapiens)
MiRBase ID hsa-mir-219a-2
Paralogues Hsa-Mir-219-P2-as  Hsa-Mir-219-P3 
Orthologues Aae-Mir-219  Aca-Mir-219-P2  Ami-Mir-219-P2  Bfl-Mir-219  Bge-Mir-219  Bla-Mir-219  Bta-Mir-219-P2  Bta-Mir-219-P2-as  Cfa-Mir-219-P2  Cfa-Mir-219-P2-as  Cgi-Mir-219  Cin-Mir-219  Cli-Mir-219-P2  Cmi-Mir-219-P2  Cpi-Mir-219-P2  Cpo-Mir-219-P2  Cpo-Mir-219-P2-as  Csc-Mir-219  Cte-Mir-219  Dan-Mir-219  Dma-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P2  Dno-Mir-219-P2-as  Dpu-Mir-219  Dre-Mir-219-P2a  Dre-Mir-219-P2b  Dsi-Mir-219  Dya-Mir-219  Esc-Mir-219  Ete-Mir-219-P2  Gga-Mir-219-P2  Gja-Mir-219-P2  Gmo-Mir-219-P2a  Isc-Mir-219  Lan-Mir-219  Lch-Mir-219-P2  Loc-Mir-219-P2  Mal-Mir-219-P2a  Mal-Mir-219-P2b  Mdo-Mir-219-P2  Mml-Mir-219-P2  Mml-Mir-219-P2-as  Mmu-Mir-219-P2  Mmu-Mir-219-P2-as  Mun-Mir-219-P2  Oan-Mir-219-P2  Obi-Mir-219  Ocu-Mir-219-P2  Ocu-Mir-219-P2-as  Ovu-Mir-219  Pbv-Mir-219-P2  Pfl-Mir-219  Pma-Mir-219-o2  Pmi-Mir-219  Rno-Mir-219-P2  Rno-Mir-219-P2-as  Sha-Mir-219-P2  Sko-Mir-219  Spt-Mir-219-P2  Spu-Mir-219  Sto-Mir-219-P2  Tca-Mir-219  Tgu-Mir-219-P2  Tni-Mir-219-P2a  Tni-Mir-219-P2b  Xbo-Mir-219  Xla-Mir-219-P2c  Xla-Mir-219-P2d  Xtr-Mir-219-P2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(hg38)
chr9: 128392632-128392696 [-] UCSC Ensembl
Clustered miRNAs
(< 50kb from Mir-219-P2)
Mir-219-P2 chr9: 128392632-128392696 [-] UCSC Ensembl
Mir-219-P2-as chr9: 128392634-128392698 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCAGGGCCCUGAACUCAGGGGCUUCGCCACUGAUUGUCCAAACGCAAUUCUUGUACGAGUCUGCGGCCAACCGAGAAUUGUGGCUGGACAUCUGUGGCUGAGCUCCGGGCGCAACAGGGGCGGGG
Get precursor sequence
Structure
        10          20        30        40        50        60  
CCAGGGCCCUGAACUCA--|      C     U   U     AA           UACGAGUC 
                   GGGGCUU GCCAC GAU GUCCA  CGCAAUUCUUG        U
                   CCUCGAG CGGUG CUA CAGGU  GUGUUAAGAGC        G
GGGGCGGGGACAACGCGGG^      U     U   -     CG           CAACCGGC 
   120       110       100        90         80        70
Deep sequencing
Go to detailed chart
CommentThe MIR-219 family shows substantial variation of arm-usage and is currently, across all species, considered a co-mature.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
1- 1- 1- 1- 1- 1- 1- 1- 1- 1- 1- 1- 1- 2- 2- 2- 2- 2- 2- 2- 2- 2- 2- 2- 3- 3- 3- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 4- 5- 5- 5- 5- 5- 5- 5- 6- 6- 6- 6- 6-
Mature sequence

Hsa-Mir-219-P2_5p

mirBase accessionMIMAT0000276
Sequence
0- UGAUUGUCCAAACGCAAUUCUUG -23
Get sequence
Proposed targets microrna.org: MIMAT0000276
TargetScanVert: hsa-miR-219a-5p
miRDB: MIMAT0000276
Co-mature sequence

Hsa-Mir-219-P2_3p

mirBase accessionMIMAT0004675
Sequence
43- AGAAUUGUGGCUGGACAUCUGU -65
Get sequence
Proposed targets microrna.org: MIMAT0004675
TargetScanVert: hsa-miR-219a-2-3p
miRDB: MIMAT0004675