MirGeneDB 3.0

MirGeneDB ID

Sko-Mir-219

Family name MIR-219 (all species)
Seed GAUUGUC
Species Saccoglossus (Saccoglossus kowalevskii)
MiRBase ID sko-mir-219
Paralogues
Orthologues Aae-Mir-219  Aca-Mir-219-P2  Aca-Mir-219-P3  Aga-Mir-219  Agr-Mir-219  Ami-Mir-219-P2  Ami-Mir-219-P3  Ava-Mir-219-P13  Ava-Mir-219-P14  Bfl-Mir-219  Bge-Mir-219  Bko-Mir-219  Bla-Mir-219  Bpl-Mir-219  Bta-Mir-219-P2  Bta-Mir-219-P2-as  Bta-Mir-219-P3  Cfa-Mir-219-P2  Cfa-Mir-219-P2-as  Cfa-Mir-219-P3  Cin-Mir-219  Cja-Mir-219-P2  Cja-Mir-219-P3  Cli-Mir-219-P2  Cmi-Mir-219-P2  Cmi-Mir-219-P3  Cpi-Mir-219-P2  Cpi-Mir-219-P3  Cpo-Mir-219-P2  Cpo-Mir-219-P2-as  Cpo-Mir-219-P3  Csc-Mir-219  Cte-Mir-219  Dan-Mir-219  Dgr-Mir-219  Dlo-Mir-219  Dma-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P2  Dno-Mir-219-P2-as  Dno-Mir-219-P3  Dpu-Mir-219  Dre-Mir-219-P2a  Dre-Mir-219-P2b  Dre-Mir-219-P3a  Dsi-Mir-219  Dya-Mir-219  Eba-Mir-219  Ebu-Mir-219-P5  Ebu-Mir-219-P6  Eca-Mir-219-P2  Eca-Mir-219-P3  Efe-Mir-219-P7  Efe-Mir-219-P8  Efe-Mir-219-P9  Egr-Mir-219  Esc-Mir-219  Ete-Mir-219-P2  Ete-Mir-219-P3  Gga-Mir-219-P2  Gja-Mir-219-P2  Gja-Mir-219-P3  Gmo-Mir-219-P2a  Gmo-Mir-219-P3a  Gmo-Mir-219-P3b  Gpa-Mir-219  Gsa-Mir-219  Gsp-Mir-219  Hmi-Mir-219  Hru-Mir-219  Hsa-Mir-219-P2  Hsa-Mir-219-P2-as  Hsa-Mir-219-P3  Isc-Mir-219  Laf-Mir-219-P2  Laf-Mir-219-P3  Lan-Mir-219  Lch-Mir-219-P2  Lch-Mir-219-P3  Llo-Mir-219  Loc-Mir-219-P2  Lpo-Mir-219-P20  Lpo-Mir-219-P21  Lpo-Mir-219-P22  Lpo-Mir-219-P23  Lpo-Mir-219-P24  Mal-Mir-219-P2a  Mal-Mir-219-P2b  Mal-Mir-219-P3a  Mal-Mir-219-P3b  Mdo-Mir-219-P2  Mdo-Mir-219-P3  Mgi-Mir-219  Mml-Mir-219-P2  Mml-Mir-219-P2-as  Mml-Mir-219-P3  Mmr-Mir-219-P2  Mmr-Mir-219-P3  Mmu-Mir-219-P2  Mmu-Mir-219-P2-as  Mmu-Mir-219-P3  Mmu-Mir-219-P3-as  Mom-Mir-219  Mun-Mir-219-P2  Mun-Mir-219-P3-v1  Mun-Mir-219-P3-v2  Neu-Mir-219-P2  Neu-Mir-219-P3  Oan-Mir-219-P2  Obi-Mir-219  Ocu-Mir-219-P2  Ocu-Mir-219-P2-as  Ocu-Mir-219-P3  Ofu-Mir-219  Ovu-Mir-219  Pab-Mir-219-P2  Pab-Mir-219-P2-as  Pab-Mir-219-P3  Pau-Mir-219  Pbv-Mir-219-P2  Pbv-Mir-219-P3  Pca-Mir-219  Pcr-Mir-219  Pdu-Mir-219-P14a  Pdu-Mir-219-P14b  Pfl-Mir-219  Pma-Mir-219-o1  Pma-Mir-219-o2  Pmi-Mir-219  Pve-Mir-219  Rno-Mir-219-P2  Rno-Mir-219-P2-as  Rno-Mir-219-P3  Rph-Mir-219  Sha-Mir-219-P2  Sha-Mir-219-P3  Sma-Mir-219  Sme-Mir-219-P10a  Sme-Mir-219-P10b  Sne-Mir-219  Snu-Mir-219  Spt-Mir-219-P2  Spt-Mir-219-P3  Spu-Mir-219  Sro-Mir-219  Sto-Mir-219-P2  Sto-Mir-219-P3-v1  Sto-Mir-219-P3-v2  Tca-Mir-219  Tgu-Mir-219-P2  Tni-Mir-219-P2a  Tni-Mir-219-P2b  Tni-Mir-219-P3a  Tni-Mir-219-P3b  Tur-Mir-219  War-Mir-219  Xbo-Mir-219  Xla-Mir-219-P2c  Xla-Mir-219-P2d  Xtr-Mir-219-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Skow_1.1)
NW_003111333.1: 5536-5597 [-]
Precursor
(pre-Mir +30nt flank)
AUCUGGUAUGGACGUCUUGGUGACAAGCUCUGAUUGUCCAAACGCAAUUCUUGUGUUUUCUUAACUAAACAAGAGCUGUGCUGGGCAUCACAAGUUGUCAUCAACAAUCAACAAUACAACUU
Get precursor sequence
Structure
        10          20        30         40        50        60 
AUCUGGUAUGGACGUCU--|        G  C-    U     AA    A      UGUUUUC 
                   UGGUGACAA CU  UGAU GUCCA  CGCA UUCUUG       U
                   ACUACUGUU GA  ACUA CGGGU  GUGU GAGAAC       U
UUCAACAUAACAACUAACA^        -  AC    -     C-    C      AAAUCAA 
120       110       100         90          80        70
Deep sequencing
CommentThere are approximately 30 Mir-219 loci in S. kowalevskii clustered on a single genomic trace but only one is annotated here as there are no Mir-219 reads in the initial 454 library. The MIR-219 family shows substantial variation of arm-usage and is currently, across all species, considered a co-mature.
3' NTU Unknown
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Sko-Mir-219_5p (predicted)

mirBase accessionMIMAT0022768
Sequence
0- UGAUUGUCCAAACGCAAUUCUUG -23
Get sequence
Co-mature sequence

Sko-Mir-219_3p (predicted)

mirBase accessionNone
Sequence
41- AGAGCUGUGCUGGGCAUCACA -62
Get sequence