MirGeneDB 2.1

MirGeneDB ID

Mmu-Let-7-P1b

Family name LET-7 (all species)
Seed GAGGUAG
Species House mouse (Mus musculus)
MiRBase ID mmu-let-7e
Paralogues Mmu-Let-7-P1c  Mmu-Let-7-P1d  Mmu-Let-7-P2a1  Mmu-Let-7-P2a2  Mmu-Let-7-P2a3  Mmu-Let-7-P2b1  Mmu-Let-7-P2b2  Mmu-Let-7-P2b3  Mmu-Let-7-P2c1  Mmu-Let-7-P2c2  Mmu-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P1b  Ami-Let-7-P1b  Bge-Let-7  Bpl-Let-7  Bta-Let-7-P1b  Cfa-Let-7-P1b  Cgi-Let-7  Cin-Let-7-P1  Cpi-Let-7-P1b  Cpo-Let-7-P1b  Cte-Let-7  Dan-Let-7  Dma-Let-7  Dme-Let-7  Dmo-Let-7  Dpu-Let-7  Dre-Let-7-P1b1  Dre-Let-7-P1b2  Dsi-Let-7  Dya-Let-7  Esc-Let-7  Ete-Let-7-P1b  Gja-Let-7-P1b  Gmo-Let-7-P1b1  Gmo-Let-7-P1b2  Hme-Let-7  Hsa-Let-7-P1b  Isc-Let-7  Lan-Let-7  Lch-Let-7-P1b  Lgi-Let-7  Loc-Let-7-P1b  Mal-Let-7-P1b1  Mal-Let-7-P1b2  Mdo-Let-7-P1b  Mml-Let-7-P1b  Mun-Let-7-P1b  Npo-Let-7  Oan-Let-7-P1b  Obi-Let-7  Ocu-Let-7-P1b  Ovu-Let-7  Pbv-Let-7-P1b  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P1b  Sha-Let-7-P1b  Sko-Let-7  Spt-Let-7-P1b  Spu-Let-7  Sto-Let-7-P1b  Tca-Let-7  Tni-Let-7-P1b1  Tni-Let-7-P1b2  Xbo-Let-7  Xla-Let-7-P1b3  Xla-Let-7-P1b4  Xtr-Let-7-P1b 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr17: 17830366-17830432 [+] UCSC Ensembl
Clustered miRNAs
(< 50kb from Let-7-P1b)
Mir-10-P2b chr17: 17830194-17830253 [+] UCSC Ensembl
Let-7-P1b chr17: 17830366-17830432 [+] UCSC Ensembl
Mir-10-P3b chr17: 17830817-17830876 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAAUCUGCCCACCUGCCGCGCCCCCCGGGCUGAGGUAGGAGGUUGUAUAGUUGAGGAAGACACCCGAGGAGAUCACUAUACGGCCUCCUAGCUUUCCCCAGGCUGCGCCCUGCACUGGAAGGGGCCG
Get precursor sequence
Structure
        10          20        30        40        50        60   
CAAUCUGCCCACCUGCC--|   CC  C   CU   G                UGAGGAAGACA 
                   GCGC  CC GGG  GAG UAGGAGGUUGUAUAGU           \
                   CGCG  GG CCC  UUC AUCCUCCGGCAUAUCA           C
GCCGGGGAAGGUCACGUCC^   UC  A   CU   G                CUAGAGGAGCC 
     120       110       100        90        80        70
Deep sequencing
3' NTU No
MotifsNo
Tissue expression
 +
Bo Br Br Ce Em Em He In Ki Li Lu Mu Ov Pa Sk Sp Sp Te
Mature sequence

Mmu-Let-7-P1b_5p

mirBase accessionMIMAT0000524
Sequence
0- UGAGGUAGGAGGUUGUAUAGUU -22
Get sequence
Proposed targets microrna.org: MIMAT0000524
TargetScanVert: mmu-let-7e-5p
miRDB: MIMAT0000524
Star sequence

Mmu-Let-7-P1b_3p*

mirBase accessionMIMAT0017016
Sequence
45- CUAUACGGCCUCCUAGCUUUCC -67
Get sequence
Proposed targets TargetScanVert: mmu-let-7e-3p
miRDB: MIMAT0017016