MirGeneDB 2.1

MirGeneDB ID

Mmu-Let-7-P2b3

Family name LET-7 (all species)
Seed GAGGUAG
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-98
Paralogues Mmu-Let-7-P1b  Mmu-Let-7-P1c  Mmu-Let-7-P1d  Mmu-Let-7-P2a1  Mmu-Let-7-P2a2  Mmu-Let-7-P2a3  Mmu-Let-7-P2b1  Mmu-Let-7-P2b2  Mmu-Let-7-P2c1  Mmu-Let-7-P2c2  Mmu-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P2b3  Ami-Let-7-P2b3  Bge-Let-7  Bpl-Let-7  Bta-Let-7-P2b3  Cfa-Let-7-P2b3  Cgi-Let-7  Cpi-Let-7-P2b3  Cpo-Let-7-P2b3  Cte-Let-7  Dan-Let-7  Dma-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P2b3  Dpu-Let-7  Dre-Let-7-P2b3a  Dsi-Let-7  Dya-Let-7  Esc-Let-7  Ete-Let-7-P2b3  Gja-Let-7-P2b3  Gmo-Let-7-P2b3a  Gmo-Let-7-P2b3b  Hme-Let-7  Hsa-Let-7-P2b3  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Loc-Let-7-P2b3  Mal-Let-7-P2b3a  Mml-Let-7-P2b3  Mun-Let-7-P2b3  Npo-Let-7  Oan-Let-7-P2b3  Obi-Let-7  Ocu-Let-7-P2b3  Ovu-Let-7  Pbv-Let-7-P2b3  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P2b3  Sko-Let-7  Spt-Let-7-P2b3  Spu-Let-7  Sto-Let-7-P2b3  Tca-Let-7  Tni-Let-7-P2b3a  Tni-Let-7-P2b3b  Xbo-Let-7  Xla-Let-7-P2b3c  Xla-Let-7-P2b3d  Xtr-Let-7-P2b3 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(mm10)
chrX: 151913229-151913307 [+] UCSC Ensembl
Clustered miRNAs
(< 50kb from Let-7-P2b3)
Let-7-P2a3 chrX: 151912353-151912423 [+] UCSC Ensembl
Let-7-P2b3 chrX: 151913229-151913307 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUUACUAGACACAUCUGCACAUGCUGGGGUGAGGUAGUAAGUUGUAUUGUUGUGGGGUAGGGAUUUUAGGCCCCAGUAAGAAGAUAACUAUACAACUUACUACUUUCCUUGGUGUGUGGCAUAUUCACAUUAAGUCUU
Get precursor sequence
Structure
        10          20        30        40        50        60         
CCUUACUAGACACAUCUG--|      UG   U                 U   GUGGGGUAGGGAUUUU 
                    CACAUGC  GGG GAGGUAGUAAGUUGUAU GUU                A
                    GUGUGUG  UCC UUUCAUCAUUCAACAUA CAA                G
UUCUGAAUUACACUUAUACG^      GU   -                 U   UAGAAGAAUGACCCCG 
       130       120       110        100        90        80        70
Deep sequencing
3' NTU Yes
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
Bo Br Br Ce Em Em He In Ki Li Lu Mu Ov Pa Sk Sp Sp Te
Mature sequence

Mmu-Let-7-P2b3_5p

mirBase accessionMIMAT0000545
Sequence
0- UGAGGUAGUAAGUUGUAUUGUU -22
Get sequence
Proposed targets microrna.org: MIMAT0000545
TargetScanVert: mmu-miR-98-5p
miRDB: MIMAT0000545
Star sequence

Mmu-Let-7-P2b3_3p*

mirBase accessionMIMAT0017023
Sequence
58- CUAUACAACUUACUACUUUCC -79
Get sequence
Proposed targets TargetScanVert: mmu-miR-98-3p
miRDB: MIMAT0017023