MirGeneDB 2.1

MirGeneDB ID

Mmu-Let-7-P1c

Family name LET-7 (all species)
Seed GAGGUAG
Species House mouse (Mus musculus)
MiRBase ID mmu-let-7c-1
Paralogues Mmu-Let-7-P1b  Mmu-Let-7-P1d  Mmu-Let-7-P2a1  Mmu-Let-7-P2a2  Mmu-Let-7-P2a3  Mmu-Let-7-P2b1  Mmu-Let-7-P2b2  Mmu-Let-7-P2b3  Mmu-Let-7-P2c1  Mmu-Let-7-P2c2  Mmu-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P1c  Ami-Let-7-P1c  Bge-Let-7  Bpl-Let-7  Bta-Let-7-P1c  Cfa-Let-7-P1c  Cgi-Let-7  Cin-Let-7-P1  Cli-Let-7-P1c  Cpi-Let-7-P1c  Cpo-Let-7-P1c  Cte-Let-7  Dan-Let-7  Dma-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P1c  Dpu-Let-7  Dre-Let-7-P1c1  Dre-Let-7-P1c2  Dsi-Let-7  Dya-Let-7  Esc-Let-7  Ete-Let-7-P1c  Gga-Let-7-P1c  Gja-Let-7-P1c  Gmo-Let-7-P1c2  Hme-Let-7  Hsa-Let-7-P1c  Isc-Let-7  Lan-Let-7  Lch-Let-7-P1c  Lgi-Let-7  Loc-Let-7-P1c  Mal-Let-7-P1c2  Mml-Let-7-P1c  Mun-Let-7-P1c  Npo-Let-7  Oan-Let-7-P1c  Obi-Let-7  Ocu-Let-7-P1c  Ovu-Let-7  Pbv-Let-7-P1c  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P1c  Sha-Let-7-P1c  Sko-Let-7  Spt-Let-7-P1c  Spu-Let-7  Sto-Let-7-P1c  Tca-Let-7  Tgu-Let-7-P1c  Xbo-Let-7  Xla-Let-7-P1c3  Xla-Let-7-P1c4  Xtr-Let-7-P1c 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr16: 77599672-77599738 [+] UCSC Ensembl
Clustered miRNAs
(< 50kb from Let-7-P1c)
Mir-10-P2c chr16: 77598940-77598998 [+] UCSC Ensembl
Let-7-P1c chr16: 77599672-77599738 [+] UCSC Ensembl
Mir-10-P3c chr16: 77646279-77646339 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAAACAUUGGAAGCUGUGUGCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGCACACUUGAGCCAUCGAGGAAUUC
Get precursor sequence
Structure
        10           20        30        40        50        60   
AGAAACAUUGGAAGCUG---|    A      UU   G   U             UAGAGUUACA 
                    UGUGC UCCGGG  GAG UAG AGGUUGUAUGGUU          \
                    ACACG AGGUUC  UUC AUC UCCAACAUGUCAA          C
CUUAAGGAGCUACCGAGUUC^    -      CU   G   U             UUGAGGGUCC 
     120       110        100        90        80        70
Deep sequencing
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Br Br Ce Em Em He In Ki Li Lu Mu Ov Pa Sk Sp Sp Te
Mature sequence

Mmu-Let-7-P1c_5p

mirBase accessionMIMAT0000523
Sequence
0- UGAGGUAGUAGGUUGUAUGGUU -22
Get sequence
Proposed targets microrna.org: MIMAT0000523
TargetScanVert: mmu-let-7c-5p
miRDB: MIMAT0000523
Star sequence

Mmu-Let-7-P1c_3p*

mirBase accessionMIMAT0004622
Sequence
45- CUGUACAACCUUCUAGCUUUCC -67
Get sequence
Proposed targets microrna.org: MIMAT0004622
TargetScanVert: mmu-let-7c-1-3p
miRDB: MIMAT0004622