MirGeneDB 2.1

MirGeneDB ID

Mmu-Mir-214-v2

Family name MIR-214 (all species)
Seed ACAGCAG
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-214
Paralogues Mmu-Mir-214-v1 
Orthologues Aca-Mir-214-v2  Ami-Mir-214-v2  Bta-Mir-214-v2  Cfa-Mir-214-v2  Cli-Mir-214-v2  Cmi-Mir-214-v2  Cpi-Mir-214-v2  Cpo-Mir-214-v2  Dno-Mir-214-v2  Ete-Mir-214-v2  Gga-Mir-214-v2  Gja-Mir-214-v2  Hsa-Mir-214-v2  Lch-Mir-214  Loc-Mir-214-v2  Mdo-Mir-214-v2  Mml-Mir-214-v2  Mun-Mir-214  Oan-Mir-214-v2  Ocu-Mir-214-v2  Pbv-Mir-214-v2  Rno-Mir-214-v2  Sha-Mir-214-v2  Spt-Mir-214  Sto-Mir-214-v2  Tgu-Mir-214-v2  Xtr-Mir-214-v2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(mm10)
chr1: 162223397-162223459 [+] UCSC Ensembl
Clustered miRNAs
(< 50kb from Mir-214-v2)
Mir-199-P1-v1 chr1: 162217844-162217904 [+] UCSC Ensembl
Mir-199-P1-v2 chr1: 162217844-162217904 [+] UCSC Ensembl
Mir-199-P1-v3 chr1: 162217844-162217904 [+] UCSC Ensembl
Mir-214-v1 chr1: 162223397-162223459 [+] UCSC Ensembl
Mir-214-v2 chr1: 162223397-162223459 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCUGAAUGACCACCA
Get precursor sequence
Structure
        10          20        30        40        50        60 
GGGCCUGGCUGGACAGA--|          U          ACA           GAACAUC 
                   GUUGUCAUGUG CUGCCUGUCU   CUUGCUGUGCA       \
                   CAACAGUACAC GACGGACAGA   GGACGACAUGU       C
ACCACCAGUAAGUCCGACC^          U          CAC           CCACUCG 
 120       110       100        90        80        70
Deep sequencing
3' NTU No
MotifsNo
Tissue expression
 +
Bo Br Br Ce Em Em He In Ki Li Lu Mu Ov Pa Sk Sp Sp Te
Star sequence

Mmu-Mir-214-v2_5p*

mirBase accessionMIMAT0004664
Sequence
0- UGCCUGUCUACACUUGCUGUGCA -23
Get sequence
Proposed targets microrna.org: MIMAT0004664
TargetScanVert: mmu-miR-214-5p
miRDB: MIMAT0004664
Mature sequence

Mmu-Mir-214-v2_3p

mirBase accessionMIMAT0000661
Sequence
40- UACAGCAGGCACAGACAGGCAGU -63
Get sequence
Proposed targets microrna.org: MIMAT0000661
TargetScanVert: mmu-miR-214-3p
miRDB: MIMAT0000661