MirGeneDB ID | Bfl-Mir-22-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-22 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | CAGCUCC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Florida lancelet (Branchiostoma floridae) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | bfl-mir-4868a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Bfl-Mir-22-o3d Bfl-Mir-22-o3e Bfl-Mir-22-P1 Bfl-Mir-22-P2b Bfl-Mir-22-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Aae-Mir-22-P2 Aga-Mir-22-P2 Agr-Mir-22-P2 Asu-Mir-22-P2 Bge-Mir-22-P2 Bla-Mir-22-P2a Cbr-Mir-22-P2-v1 Cbr-Mir-22-P2-v2 Cel-Mir-22-P2 Csc-Mir-22-P2 Cte-Mir-22-P2 Dan-Mir-22-P2 Dlo-Mir-22-P2 Dma-Mir-22-P2 Dme-Mir-22-P2 Dmo-Mir-22-P2 Dpu-Mir-22-P2 Dsi-Mir-22-P2 Dya-Mir-22-P2 Eba-Mir-22-P2 Esc-Mir-22-P2 Gpa-Mir-22-P2 Hme-Mir-22-P2 Hru-Mir-22-P2 Isc-Mir-22-P2 Lan-Mir-22-P2 Lgi-Mir-22-P2 Lhy-Mir-22-P2 Llo-Mir-22-P2 Mgi-Mir-22-P2 Mom-Mir-22-P2 Npo-Mir-22-P2 Ovu-Mir-22-P2 Pau-Mir-22-P2 Pca-Mir-22-P2 Pdu-Mir-22-P2 Pfl-Mir-22-P2 Pmi-Mir-22-P2 Pve-Mir-22-P2 Rph-Mir-22-P2 Sko-Mir-22-P2 Snu-Mir-22-P2 Spu-Mir-22-P2 Tca-Mir-22-P2-v1 Tca-Mir-22-P2-v2 Tur-Mir-22-P2 War-Mir-22-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Branchiostoma | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCF_000003815.2_Bfl_VNyyK_genomic) |
NC_049981.1: 9953158-9953217 [-] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-22-P2a) |
Mir-22-P2b
NC_049981.1: 9942475-9942534 [-]
UCSC
Mir-4868-P2 NC_049981.1: 9942475-9942534 [-] UCSC Mir-22-P2a NC_049981.1: 9953158-9953217 [-] UCSC Mir-4868-P1 NC_049981.1: 9953158-9953217 [-] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) | AGAUUGAGAAAUGAUGUGGUCUUCUCGCCCCUGAUCAGCCCGGAAGCUGUUACGUCACUUCCGUUGUAUCAGCUCCAGCGCUGAUCAGUGACGCGGUGACUUAAAAACAACUACGCCAGGGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 AGAUUGAGAAAUGAUGU-- UU U CC-- CC-| A U CGUCAC GGUC C CGC CUGAUCAGC GGA GCUG UA U UCAG G GCG GACUAGUCG CCU CGAC AU U GGACCGCAUCAACAAAAAU U- - CAGU CGA^ - U GUUGCC . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is unclear if this paralogue group represents the ancestral Mir-22-P2 gene that is seed shifted or a new paralogue derived from the ancestral P1 gene. It is also unclear if this gene is orthologous to the Mir-22-o2 gene in ambulacrarians. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Bfl-Mir-22-P2a_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- CUGAUCAGCCCGGAAGCUGUUA -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Bfl-Mir-22-P2a_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | MIMAT0020104 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
38- UCAGCUCCAGCGCUGAUCAGUG -60
Get sequence
|