MirGeneDB 2.1

MirGeneDB ID

Spu-Mir-8

Family name MIR-8 (all species)
Seed AAUACUG
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-200
Paralogues
Orthologues Aae-Mir-8  Aca-Mir-8-P1a  Aca-Mir-8-P2a  Aca-Mir-8-P3a  Ami-Mir-8-P1a  Ami-Mir-8-P2a  Ami-Mir-8-P3a  Asu-Mir-8  Bfl-Mir-8-P1-v1  Bfl-Mir-8-P1-v2  Bfl-Mir-8-P2  Bfl-Mir-8-P3  Bge-Mir-8  Bla-Mir-8-P1  Bla-Mir-8-P2  Bla-Mir-8-P3  Bpl-Mir-8  Bta-Mir-8-P1a  Bta-Mir-8-P1b  Bta-Mir-8-P2a  Bta-Mir-8-P2b  Bta-Mir-8-P3a  Cbr-Mir-8  Cel-Mir-8  Cfa-Mir-8-P1a  Cfa-Mir-8-P1b  Cfa-Mir-8-P2a  Cfa-Mir-8-P2b  Cfa-Mir-8-P3a  Cgi-Mir-8  Cin-Mir-8-P1  Cin-Mir-8-P2  Cli-Mir-8-P1a  Cli-Mir-8-P2a  Cli-Mir-8-P3a  Cmi-Mir-8-P1a  Cmi-Mir-8-P2a  Cmi-Mir-8-P3a  Cpi-Mir-8-P1a  Cpi-Mir-8-P2a  Cpi-Mir-8-P3a  Cpo-Mir-8-P1a  Cpo-Mir-8-P1b  Cpo-Mir-8-P2a  Cpo-Mir-8-P2b  Cpo-Mir-8-P3a  Csc-Mir-8  Cte-Mir-8  Dan-Mir-8  Dma-Mir-8  Dme-Mir-8  Dmo-Mir-8  Dno-Mir-8-P1a  Dno-Mir-8-P2a  Dno-Mir-8-P2b  Dno-Mir-8-P3a  Dpu-Mir-8  Dre-Mir-8-P1a  Dre-Mir-8-P1b  Dre-Mir-8-P2a  Dre-Mir-8-P2b  Dre-Mir-8-P3a  Dre-Mir-8-P3b  Dsi-Mir-8  Dya-Mir-8  Ebu-Mir-8-P1o1  Ebu-Mir-8-P2o1  Ebu-Mir-8-P3o1  Efe-Mir-8-P4  Efe-Mir-8-P5  Efe-Mir-8-P6  Esc-Mir-8  Ete-Mir-8-P1a  Ete-Mir-8-P1b  Ete-Mir-8-P2a  Ete-Mir-8-P2b  Ete-Mir-8-P3a  Gga-Mir-8-P1a  Gga-Mir-8-P2a  Gga-Mir-8-P3a  Gja-Mir-8-P1a  Gja-Mir-8-P2a  Gja-Mir-8-P3a  Gmo-Mir-8-P1a  Gmo-Mir-8-P2a  Gmo-Mir-8-P3a  Hme-Mir-8  Hsa-Mir-8-P1a  Hsa-Mir-8-P1b  Hsa-Mir-8-P2a  Hsa-Mir-8-P2b  Hsa-Mir-8-P3a  Isc-Mir-8  Lan-Mir-8  Lch-Mir-8-P1a  Lch-Mir-8-P1b  Lch-Mir-8-P2a  Lch-Mir-8-P3a  Lgi-Mir-8  Loc-Mir-8-P1a  Loc-Mir-8-P2a  Loc-Mir-8-P3a  Lpo-Mir-8-P7  Lpo-Mir-8-P8  Lpo-Mir-8-P9  Lpo-Mir-8-P10  Lpo-Mir-8-P11  Lpo-Mir-8-P12  Lpo-Mir-8-P13  Mal-Mir-8-P1a  Mal-Mir-8-P2a  Mal-Mir-8-P3a  Mdo-Mir-8-P1a  Mdo-Mir-8-P1b  Mdo-Mir-8-P2a  Mdo-Mir-8-P2b  Mdo-Mir-8-P3a  Mml-Mir-8-P1a  Mml-Mir-8-P1b  Mml-Mir-8-P2a  Mml-Mir-8-P2b  Mml-Mir-8-P3a  Mmu-Mir-8-P1a  Mmu-Mir-8-P1b  Mmu-Mir-8-P2a  Mmu-Mir-8-P2b  Mmu-Mir-8-P3a  Mun-Mir-8-P1a  Mun-Mir-8-P2a  Mun-Mir-8-P3a  Npo-Mir-8  Oan-Mir-8-P1a  Oan-Mir-8-P1b  Oan-Mir-8-P2a  Oan-Mir-8-P2b  Oan-Mir-8-P3a  Obi-Mir-8  Ocu-Mir-8-P1a  Ocu-Mir-8-P1b  Ocu-Mir-8-P2a  Ocu-Mir-8-P2b  Ocu-Mir-8-P3a  Ovu-Mir-8  Pbv-Mir-8-P1a  Pbv-Mir-8-P2a  Pbv-Mir-8-P3a  Pfl-Mir-8  Pma-Mir-8-P1o2  Pma-Mir-8-P2o2  Pma-Mir-8-P3o2  Pmi-Mir-8  Rno-Mir-8-P1a  Rno-Mir-8-P1b  Rno-Mir-8-P2a  Rno-Mir-8-P2b  Rno-Mir-8-P3a  Sha-Mir-8-P1a  Sha-Mir-8-P1b  Sha-Mir-8-P2a  Sha-Mir-8-P2b  Sha-Mir-8-P3a  Sko-Mir-8  Sme-Mir-8-P14  Sme-Mir-8-P15  Spt-Mir-8-P1a  Spt-Mir-8-P2a  Spt-Mir-8-P3a  Sto-Mir-8-P1a  Sto-Mir-8-P2a  Sto-Mir-8-P3a  Tca-Mir-8  Tgu-Mir-8-P1a  Tgu-Mir-8-P2a  Tni-Mir-8-P1a  Tni-Mir-8-P2a  Tni-Mir-8-P3a  Xla-Mir-8-P1a1  Xla-Mir-8-P1a2  Xla-Mir-8-P2a1  Xla-Mir-8-P2a2  Xla-Mir-8-P3a1  Xla-Mir-8-P3a2  Xtr-Mir-8-P1a  Xtr-Mir-8-P2a  Xtr-Mir-8-P3a 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Spur_5.0)
AAGJ06000016.1: 26494529-26494591 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GUGUUUGCGAUUUGUUGAGCCUAGUGGUGACAUCAUACUGGACAGCAUUGGACGUGAUUGGAUCGUUCUCUAAUACUGUCUGGUGAUGAUGUUGACACUGGCUUUGUUUCAUCGUGGACCACU
Get precursor sequence
Structure
        10           20        30         40        50        60
GUGUUUGCGAUUUGUUG---|   U    GU        -  UG     C      CGUGAUU 
                    AGCC AGUG  GACAUCAU AC  GACAG AUUGGA       G
                    UCGG UCAC  UUGUAGUA UG  CUGUC UAAUCU       G
UCACCAGGUGCUACUUUGUU^   -    AG        G  GU     A      CUUGCUA 
 120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Star sequence

Spu-Mir-8_5p*

mirBase accessionMIMAT0013801
Sequence
0- CAUCAUACUGGACAGCAUUGGA -22
Get sequence
Mature sequence

Spu-Mir-8_3p

mirBase accessionMIMAT0009652
Sequence
40- UAAUACUGUCUGGUGAUGAUGUU -63
Get sequence